Nusos moleculars

Fa pocs dies vaig parlar de molecules en forma d’Anells de Salomó, i fet fa temps ja havia parlat de molècules borromees. Però en buscar-ne més informació em vaig topar amb un post de Chemistry World que descriu la síntesi d’un nus de trèbol (trefoil knot), amb a closure of a knotty problem.

Image

Segons el Chemistry World,

Nine years ago, Chris Hunter’s group at the University of Sheffield in the UK reported that they could use a zinc ion to tie an open knot in a linear oligomer. But ask a mathematician, and a knot isn’t a knot unless it can’t come untied – no loose ends allowed. In their latest research, Hunter’s team has followed up their oligomer-winding work, and managed to bind the loose ends together.

The oligomer includes three pairs of pyridine rings, like benzene rings with one carbon atom replaced by nitrogen. The first of these ligands binds to the central zinc ion through the nitrogen atoms. The oligomer then folds so that the second ligand binds, leaving the two ends crossed. In order for the third ligand to bind to the zinc, the long end of the oligomer must thread through the first loop, forming an open trefoil knot.

Naturalment aquest nus demana que hi hagi una cadena de monòmers, en aquest cas d’àcids nucleics. Em pregunto si en d’altres casos com el polietilè podrien formar-se nusos (una altra cosa és que les cadenes s’entrellassin i s’entortolliguin, com al cautxouc). Donc sí, a l’entrada de la wikipedia Molecular Knot n’hi ha més informació, fins i tot una molècula: el knotane (en català deuria ser nusà)

Image

 

De fet, a la mateixa wikipedia (una bona manera de felicitar-la pels 10 anys!) hi ha una proteîna (Thermus thermophilus RNA methyltransferase, amb codi PDB 1IPA) que forma un nus normal (com el de sabata abans de collar-lo) en un dels seus extrems (a la figura, de color blau).

Image

Com dir en Shakespeare: “To knot or not to knot, that’s the question

Quan tingui temps, faré alguns càlculs de molècules borromees, salomòniques i anuades, tan de polietilè com d’oligopèptids, però no serà fàcil fer servir els dissenyadors de molècules bidimensionals. Tot plegat em sembla una mica un nus molecular.

Anells de Salomó moleculars

ImageEn una entrada recent comentava un article sobre nous estats de la matèria, i com hi havia molècules que formen anells borromeus. Relacionats amb aquests també hi ha els anomenats anells de Salomó, que en lloc de tenir 3 anells com els de Borromeu, només en són 2. Naturalment es tracta d’un nus, que per cert ja figurava en mosaics romans.

Igual que per a molècules borromees, també es pot dir que hi ha molècules salomòniques, perquè al 2006 es va reportar la síntesi d’anells de Salomó moleculars. L’abstract de l’article, publicat a Angewandte Chemie, és ben curt:

With a judicious choice of ions and solvents, it is possible to amplify a molecular Solomon link by kinetically controlled crystallization from a dynamic combinatorial library of molecular knots

i a més proporciona un esquema sintétic

Image

De l’entrada de la Wikipedia se’n pot treure aquesta Molècula Salomònica, que igual que els anells de Salomó, és quiral (la sema imatge especular no és coincident)

Image

es tracta doncs d’una altre interessant exemple de química curiosa (que jo anomeno una mica quirkchemistry)

Matèria matemàtica: de sistemes borromeus i de nusos de trèbol

Fa ben pocs dies vaig veure un article arxivat provisionalment a arxiv.org sobre noves formes de la matèria, en particular referents als “Estats Efimov”: sistemes estables de tres partícules, on els tres sistemes binaris -de dues partícules- que se’n poden formar, pel contrari, no en són. Fa pocs anys Nature ja s’hi va referir per a àtoms de Cesi, i ara Nils A. Baas, un investigador del departament de ciències matemàtiques de la universitat noruega de Trondheim, ho ha formulat fent servir conceptes topològics relativament senzills com els Anells de Borromeu o els Anells de Brunn.

ImageImage

Els Anells de Borromeu, que simplificats són el logo de la marca Toyota, són el cas més senzill dels Anells de Brunn: són tres anelles entrellaçades, que no es poden separar, però que si una s’obre, les dues que queden resulten separades. En el cas dels Anells de Brunn, que precisament serveisen per fer alguns jocs de màgia, estan units en forma de cadena, però si una anella s’obre, totes queden lliures. En tots dos casos, fent servir anelles o clauers, es pot visualitzar de seguida, i permeten passar una bona estona tot construint-los.

De fet, de les molècules borromees ja en vaig parlar fa temps en aquest blog, a partir d’un article del Journal of Chemical Education (cal no confondre-les amb les molècules cícliques que formen un nus trèbol (trefoil knot), com per exemple a closure of a knotty problem, deChemistry World).

L’article d’en Baas és provocador i intrigant, i més aviat fa propostes matemàtico-recreatives que no pas investigacions en la frontera de la física. La darrera part, la que fa propostes de futur, ho deixa ben clar:

Main Prediction: To higher order links, in the sense that we have deined, there exist corresponding higher order states of matter in physical systems such as cold gases, nuclei and other types of many body systems in general.

Such states of matter may be observed in finely tuned cold gases or other systems such as Bose-Einstein condensates. It would also be interesting to see such states coming directly from a Schrödinger equation meaning that the potential is determined by the geometric hyperstructure of links and particles as described here. One would then have to take into account levels of cluster-interactions.

It would be very interesting if one could find a connection between the topology of these higher order links and the quantum entanglement. Let us conclude by mentioning that it is a natural and interesting question whether the higher order links we have introduced may be synthesized as molecules. Trefoil knots and Borromean rings have been synthesized by very sophisticated techniques. To synthesize higher order links is a daunting task, but for example Borromean rings of Borromean rings may be possible to synthesize by using DNA molecules and the techniques developed by N. Seeman.

This will be discussed in a separate paper.

Dón alloc l’Equació de Schrödinger a aquests tipus d’interaccions de tres cossos? Perquè, al final, les interaccions són només de dos cossos: les repulsions i atraccions entre protons i electrons són 2-a-2. N’hi deu haver 3-a-3? Baas es pregunta si això té relació amb l’entrellaçament quàntic. No ho sé, però en tot cas aquest efecte quàntic surt de la mecànica quàntica relativista, sense necessitat d’interaccions a 3 cossos.

Per un altre cantó, Baas fa un salt de partícules a molècules que em sembla massa fort, tot recordant les síntesis recents de molècules borromees i de molècules amb nus de trèbol . Fins i tot parla d’anells de Borromeu d’anells de Borromeu. Trímers de trímers, o fins i tot trímers de trímers de trímers.

No sé si és ciència-ficció. Però especulació, sí que n’és. I possible, també. Tot plegat, matèria matemàtica, química estranya. De totes formes, l’afirmació de News Scientist en comentar l’article d’en Baas em sembla massa agosarada:

From there, it might be possible to create new quantum states in the lab. This in turn might provide new ways to build super-powerful quantum computers, which manipulate information carried in the quantum states of particles. Such quantum information can be in many states at once, so quantum computers can carry out enormous numbers of calculations simultaneously.

Potser és per justificar la despesa o per obtenir més finançament, pèrò aquesta connexió amb la computació quàntica la veig llunyana. Més encara, el New Scientist hi dedica una editorial : The deep value of mathematics

IS MATHEMATICS a matter of invention or discovery? It is an age-old question that probably has no resolution, but this week we report on a breakthrough that backs the latter camp.

A mathematician on a geometrical safari has stumbled upon “hyperstructures” composed of interlocking rings that are themselves linked ring structures.

The discovery has set physicists hot on the trail of new states of matter (see “Make way for mathematical matter”). It is a further example of what Eugene Wigner once called “the unreasonable effectiveness of mathematics”. The most celebrated illustration is Paul Dirac’s prediction of the existence of antimatter, based on nothing more than his equations.

There are wider lessons here. Critics of string theory should take note: strings provide another area where geometry seems to provide a connection – perhaps an unreasonably effective one – with the physical world of particles and forces. Funders should also pay …

He estat pensant i comentant amb els companys en sistemes moleculars (i atòmics) ternaris estables però que no existeixin en cap de les tres possibles combinacions binàries. Si en trobem, els explicaré aquí.

Nota: explorant els llibres d’en Martin Gardner, he vist que hi ha un capítol al llibre “The Unexpected hanging and other mathematical diversions” anomenat Knots and Borromean Rings, on s’hi esmenta un article de Scientific American de 1962 titulat Chemical Topology (Edel Wasserman). El buscaré.

Bibliografia de google:

Molecular Knots and Links http://www.uni-bielefeld.de/chemie/tc/Andrae/MKL.pdf

Chemical Topology and Interlocking Molecules http://www.sciencemag.org/cgi/reprint/sci%3B304/5675/1256.pdf

Al New Scientist de 1960 (Google Books), s’hi pregunta: és això una molècula o en són dues? Perquè per separar els dos anells cal trencar un enllaç químic!

Image

Marro quàntic

Fa pocs dies que vaig conèixer per casualitat una versió diferent del “marro” o del “tres en ratlla”, tot buscant jocs de caire quàntic. A la wikipedia s’hi descriu el joc Quantum Tic Tac Toe, on el smoviemnts són força més complexos que no pas el marro normal (o les seves moltes variants popularitzdes per en Martin Garder), i demanen tenir un cert coneixement de mecànica quàntica, del concepte d’entrellaçament, i el concepte fonamental de mesura. I natualment el de col.lapse de la funció d’ona.

De fet, he instal.lat una aplicació al meu Iphone (via Apple Store) que permet jugar al Marro Quàntic. Espero poder dominar aviat (en un temps imaginari?) la maquineta.

M’agradarà en el futur conèixer altres jocs per explicar, si pot ser de forma planera, la mecànica quàntica.

Les regles d’aquest joc, ben explicades a la wikipedia, són

Quantum tic-tac-toe captures the three quantum phenomena discussed above by modifying one basic rule of classical tic-tac-toe: the number of marks allowed in each square. Additional rules specify when and how a set of marks “collapses” into classical moves.

On each move, the current player marks two squares with their letter (X or O), instead of one. The pair of marks are called spooky marks and are subscripted with the number of the move. (For example, player 1′s first move might be to place “X1” in both the upper left and lower right squares. Because X always moves first, the subscripts on X are always odd and the subscripts on O are always even.) The two squares thus marked are calledentangled. During the game, there may be as many as eight spooky marks in a single square (if the square is entangled with all eight other squares).

The phenomenon of collapse is captured by specifying that a “cyclic entanglement” causes a “measurement”. Acyclic entanglement is a cycle in the entanglement graph; for example, if square 1 is entangled via move X1 with square 4, which is entangled via move X3 with square 8, which is in turn entangled via move O4 with square 1, then these three squares form a cyclic entanglement. At the end of the turn on which the cyclic entanglement was created, the player whose turn it is not — that is, the player who did not create the cycle — chooses one of two ways to “measure” the cycle and thus cause all the entangled squares to “collapse” into classical tic-tac-toe moves. In the preceding example, since player 2 created the cycle, player 1 decides how to “measure” it. Player 1′s two options are:

  1. X1 collapses into square 1. This forces O4 to collapse into square 8 and X3 to collapse into square 4.
  2. X1 collapses into square 4. This forces X3 to collapse into square 8 and O4 to collapse into square 1.

Any other chains of entanglements hanging off the cycle would also collapse at this time; for example, if square 1 were also entangled via O2 with square 5, then either measurement above would force O2 to collapse into square 5. (Note that it is impossible for two or more cyclic entanglements to be created in a single turn.)

When a move collapses into a single square, that square is permanently marked (in larger print) with the letter and subscript of the collapsed move — a classical mark. A square containing a classical mark is fixed for the rest of the game; no more spooky marks may be placed in it.

The first player to achieve a tic-tac-toe (three in a row horizontally, vertically, or diagonally) consisting entirely ofclassical marks is declared the winner. Since it is possible for a single measurement to collapse the entire board and give classical tic-tac-toes to both players simultaneously, the rules declare that the player whose tic-tac-toe has the lower maximum subscript earns one point, and the player whose tic-tac-toe has the higher maximum subscript earns only one-half point.

Nanonaus: futbal.lens a la vista

Image

Fa uns tres anys va etiquetar-se una molècula de vuit àtoms de carboni (C8H-) com a “monstre de l’espai”, i ja llavors vaig comentar que el que seria realment interessant d’etiquetar com a molècula-monstre seria el futbal.lè. Doncs ara, potser com a conseqüència del mundial de futbol :–) s’ha descobert per espectrofotometria infraroja (i publicat a Science) realment una bona quantitat de carboni en la forma al.lotròpica de C60 (futbal.lè, ful.lerè o buckminsterful.lerè) i també de C70.

Com que a l’Antàrtida s’hi han trobat meteorits amb molècules He@C60 incrustades (àtoms d’Heli ficats dins d’una gàbia amb forma de pilota de futbol), ara el mateix investigador Kroto (Premi Nobel 1996 per la síntesi de ful.lerens) diu que es tracta de la prova que una part del carboni terrestre prové d’un origen interestel.lar.

L’entrevista de la BBC a Kroto és força interessant. Prové el carboni dels nostres cossos de ful.lerens d’altres galàxies llunyanes, fosques? Em fa l’efecte que aquesta troballa pot representar un pas molt important per a la ciència. Són els futbal.lens, que poden portar molècules a dins (igual que es proposa que portin fàrmacs a llocs determinats del cos humà) naus interespacials a escala nanomètrica, nanonaus?

En la meva columna SetCiències del Diari de Girona vaig parlar un cop del Colors Invisibles dels Estels, per explicar de forma planera com es detecten molècules a l’espai amb radiotelescopis. És així com s’ha trobar aigua en llocs remots de l’univers, i ara també s’hi troba C60 i C70 de forma abundant.

Per a aquest esdeveniment la NASA n’ha fet un petit video. El C60 és una de les molècules que ens agrada contruir de diverses formes al nostre grup quan fem divulgació científica: per exemple, la papiroflèxia (origami) molecular. Ho fem també al taller Ballant amb Bionanomolècules i al Kit BionNanoMolecular.


Embedded video from
NASA Jet Propulsion Laboratory California Institute of Technology

Criptografia genètica: secrets al genoma sintètic?

ImageNo he escrit gaire sobre l‘article publicat a Science per l’equip de Craig Venter (disponible lliurement al web d’aquesta revista) perquè no sóc expert en biologia sintètica. No crec que es tracti de vida artificial. Ho trobo ben natural, en el sentit de creat per la Natura, o sigui, creat per les persones (no sóc filòsof ni expert en ètica, així que no puc discutir amb els que en saben de veritat).

En Venter ha creat (a partir de trossos reals, sempre copiant) un nou organisme: M. mycoides JCVI-syn1.0. Però avui n’he pogut parlar una mica amb el company professor de genètica de la UdG Jordi Vinyas, que me n’ha fet cinc cèntims. De fet, ja havia llegit l’opinió de la també professora de Biologia Cel.lular de la UdG Marissa Molinas, en una entrevista al Diari de Girona d’ahir.

Com a professor d’un curs d’estiu d’Informació i Ciència, on en Carles Pla, també professor de genètica de la UdG hi imparteix una lliçó sobre informació biològica, he pogut seguir una mica tot l’assumpte de la recodificació del genoma. Ara mateix també col.laboro amb una assisgnatura Intercampus sobre el tema. L’article de Venter al Science és un avenç tecnològic sens dubte, i un exemple de tractament informacional.

ImageMés enllà dels aspectes químics, bioquímics, biològics i ètics, m’ha fet força gràcia que l’equip d’en Venter hagi posar “watermarks” en aquest genoma redissenyat. De fet, ja ho havia fet fa un temps en exemples més senzills. Ara diu que hi ha codificat l’adreça web del genoma, i algun missatge secret destinat a qui en el futur pugui desxifrar les seqüències codificades.

Com que també estic implicat al curs d’estiu de criptografia (en la part de quàntica), em diverteix que algú pugui haver encriptat (clàssicament, això sí) una adreça electrònica, paraules o altre informació en trossos de genoma no funcionals. Em pregunto si l’equip d’en Venter hi ha codificat alguna adreça de twitter. Potser intentaré descifrar-ho, ja que els watermarks estan a disposició de tothom a la documentació addicional de Science.

Com es codifica a l’ADN (una altra cosa és encriptar-ho) un text? Doncs amb les “lletres de la informàtica”. En aquesta columna de Setciències al Diari de Girona vaig explicar-ho.

La ciència avança de forma bàrbara. Crec que és per bé. I ara una reflexió.

En l’article de Craig tinc la impressió que ha passat una cosa que ja es veia venir. Al final, es tracta fonamentalment d’un desenvolupament tècnic. És una mica com la manipulació en màgia: es pot practicar, es pot millorar, es pot arribar a dominar magistralment.

Però allò que realment colpeix és el mentalisme: predir el futur, controlar la ment, llegir la ment (bé… fer-ho veure). Per això el camp on s’està a les beceroles i pot canviar el nostre futur és de la neurociència. El de la percepció, el de la consciència. Això sí que fa pensar. Som qui som o un programa creat per algú? El que hi ha a la pel.lícula Matrix (i potser també a Avatar) no és ciència ficció, sinó que pot ser realitat.

Watermarks de M. mycoides JCVI-syn1.0

Watermark-1, 1246 base pairs
TTAACTAGCTAAGTTCGAATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAATACTGTGCGCTTGACTGTGATCCTGATAAATAACTTCTTCTGTAGGGTAGAGTTTTA
TTTAAGGCTACTCACTGGTTGCAAACCAATGCCGTACATTACTAGCTTGATCCTTGGTCGGTCATTGGGGGATATCTCTTACTAATAGAGCGGCCTATCGCGTATTCTCGCCG
GACCCCCCTCTCCCACACCAGCGGTGTAGCATCACCAAGAAAATGAGGGGAACGGATGAGGAACGAGTGGGGGCTCATTGCTGATCATAATGACTGTTTATATACTAATGC
CGTCAACTGTTTGCTGTGATACTGTGCTTTCGAGGGCGGGAGATTCGTTTTTGACATACATAAATATCATGACAAAACAGCCGGTCATGACAAAACAGCCGGTCATAATAGAT
TAGCCGGTGACTGTGAAACTAAAGCTACTAATGCCGTCAATAAATATGATAATAGCAACGGCACTGACTGTGAAACTAAAGCCGGCACTCATAATAGATTAGCCGGAGTCGT
ATTCATAGCCGGTAGATATCACTATAAGGCCCAGGATCATGATGAACACAGCACCACGTCGTCGTCCGAGTTTTTTTGCTGCGACGTCTATACCACGGAAGCTGATCATAAAT
AGTTTTTTTGCTGCGGCACTAGAGCCGGACAAGCACACTACGTTTGTAAATACATCGTTCCGAATTGTAAATAATTTAATTTCGTATTTAAATTATATGATCACTGGCTATAGTC
TAGTGATAACTACAATAGCTAGCAATAAGTCATATATAACAATAGCTGAACCTGTGCTACATATCCGCTATACGGTAGATATCACTATAAGGCCCAGGACAATAGCTGAACTGA
CGTCAGCAACTACGTTTAGCTTGACTGTGGTCGGTTTTTTTGCTGCGACGTCTATACGGAAGCTCATAACTATAAGAGCGGCACTAGAGCCGGCACACAAGCCGGCACAGT
CGTATTCATAGCCGGCACTCATGACAAAACAGCGGCGCGCCTTAACTAGCTAA

Watermark-2 1081 base pairs
TTAACTAGCTAACAACTGGCAGCATAAAACATATAGAACTACCTGCTATAAGTGATACAACTGTTTTCATAGTAAAACATACAACGTTGCTGATAGTACTCCTAAGTGATAGCTT
AGTGCGTTTAGCATATATTGTAGGCTTCATAATAAGTGATATTTTAGCTACGTAACTAAATAAACTAGCTATGACTGTACTCCTAAGTGATATTTTCATCCTTTGCAATACAATAA
CTACTACATCAATAGTGCGTGATATGCCTGTGCTAGATATAGAACACATAACTACGTTTGCTGTTTTCAGTGATATGCTAGTTTCATCTATAGATATAGGCTGCTTAGATTCCCT
ACTAGCTATTTCTGTAGGTGATATACGTCCATTGCATAAGTTAATGCATTTAACTAGCTGTGATACTATAGCATCCCCATTCCTAGTGCATATTTTCATCCTAGTGCTACGTGAT
ATAATTGTACTAATGCCTGTAGATAATTTAATGCCTGGCTCGTTTGTAGGTGATAATTTAGTGCCTGTAAAACATATACCTGAGTGCTCGTTGCGTGATAGTTCGTTCATGCAT
ATACAACTAGGCTGCTGTGATATGGTCACTGCCCTTACTGTGCTACATATTACTGCGAGGGGGATGACGTATAAACCTGTTGTAAGTGATATGACGTATATAACTACTAGTGA
TATGACGTATAGGCTAGAACAACGTGATATGACGTATATGACTACTGTCCCAAACATCAGTGATATGACGTATACTATAATTTCTATAATAGTGATAAATAAACCTGGGCTAAA
TACGTTCCTGAATACGTGGCATAAACCTGGGCTAACGAGGAATACCCATAGTTTAGCAATAAGCTATAGTTCGTCATTTTTAAGGCGCGCCTTAACTAGCTAA

Watermark-3 1109 base pairs
TTAACTAGCTAATTTAACCATATTTAAATATCATCCTGATTTTCACTGGCTCGTTGCGTGATATAGATTCTACTGTAGTGCTAGATAGTTCTGTACTAGGTGATACTATAGATTTC
ATAGATAGCACTACTGGCTTCATGCTAGGCATCCCAATAGCTAGTGATAGTTTAGTGCATACAACGTCATGTGATACAACGTTGCTGGCTGTAGATACAACGTCGTATTCTGT
AAGTGATACAATAGCTATTGCTGTGCATAGGCCTATAGTGGCTGTAACTAGTGATATCACGTAACAACCATATAAGTTAGATTTAATGCCCCTGACTGAACGCTCGTTGCGTG
ATAGTTTAGGCTCGTTGCATACAACTGTGATTTTCATAAAACAACGTGATAATTTAGTGCTAGATAAGTTCCGCTTAGCAAGTGATAGTTTCCGCTTGACTGTGCATAGTTCGT
TCATGCGCTCGTTGCGTGATAAACTAGGCAGCTTCACAACTGATAATTTAATTGCTGATATTGCTGGCTGTCTAGTGCTAGTGATCATAGTGCGTGATAGTTTAAGCTGCTCT
GTTTTAGATATCACGTGCTTGATAATGAAACTAACTAGTGATACTACGTAGTTAACTATGAATAGGCCTACTGTAAATTCAATAGTGCGTGATATTGAACTAGATTCTGCAACTG
CTAATATGCCGTGCTGCACGTTTGGTGATAGTTTAGCATGCTTCACTATAATAAATATGGTAGTTGTAACTACTGCGAATAGGGGGAGCTTAATAAATATGATCACTGTGCTAC
GCTATATGCCGTTGAATATAGGCTATATGATCATAACATATATAGCTATAAGTGATAAGTTCCTGAATATAGGCTATATGATCATAACATATACAACTGTACTCATGAATAAGTT
AACGAGGATTAACTAGCTAA

Watermark-4 1222 base pairs
TTAACTAGCTAATTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTCCCACAGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTACATAACA
TCATAGTGCGTGATAAACCTGATACAATAGGTGATATCATAGCAACTGAACTGACGTTGCATAGCTCAACTGTGATCAGTGATATAGATTCTGATACTATAGCAACGTTGCGT
GATATTTTCACTACTGGCTTGACTGTAGTGCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAGTGATA
TAATCCAACTAGATAGTCCTGAACTGATCCCTATGCTAACTAGTGATAAACTAACTGATACATCGTTCCTGCTACGTGATAGCTTCACTGAGTTCCATACATCGTCGTGCTTAA
ACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAACTAGTGATATGACTGCAAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATTCTGTAGTGCTAGATA
CTATAGATTTCCTGCTAAGTGATAAGTCTACTGATTTACTAATGAATAGCTTGGTTTTGGCATACACTGTGCGCTGCACTGGTGATAGCTTTTCGTTGATGAATAATTTCCCTA
GCACTGTGCGTGATATGCTAGATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGGTGATAGTTTAGTTGCTGTAACTAATATTATCCCTGTGCCGTTGCTAAGCTGTGATA
TCATAGTGCTGCTAGATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCTCATAGTGAATACTGATATTTTAGTGCTGCCGTTGAATAAGTTCCCTGAACATTGTGATACT
GATATTTTAGTGCTGCCGTTGAATATCCTGCATTTAACTAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTAATTATAGGCTAACATTGCCAATAGTGC
GGCGCGCCTTAACTAGCTAA

Computació Quàntica en Química Quàntica: la molècula d’hidrogen

ImageFins ara, la computació quàntica estava restringida a casos especials, normalment relacionats amb les ciències de la informació. Ara fa unes setmanes, però, la revista Nature Chemistry va publicar un article on s’hi feia un càlcul real de la molècula d’hidrogen, fent servir un ordinador quàntic basat en tècniques fotòniques. Ho va recollir Chemistry World amb una entrada titulada Quantum computer hits hydrogen bullseye (amb la foto que il.lustra aquesta entrada, que és l’ordinador quàntic que es va fer servir). L’article es troba al repositori Arxiv, a part del propi Nature Chemistry (accés restringit)

Es tracta de la primera computación quàntica d’un sistema quàntic (amb un ordinador clàssic aquest càlcul és molt ràpid, potser centèsimes de segon). És a dir, de la determinació de la corba d’energia potencial de la molècula d’hidrogen: per un cantó l’energia de dissociació i la distància d’equilibri, per un segon les energies de diversos estats electrònics, cosa que permet saber el seu espectre electrònic (“color”), i per un altre la forma de la corba, que permet tenir una estimació del seu espectre infraroig. Tot plegat fent servir els anomenats mètodes “ab initio”, que parteixen de l’equació de Schrödinger, sense cap paràmetre experimental.

Es tracta d’un petit pas, però que pot ser molt significatiu, com diu Kenneth Brown també a Nature Chemistry en la mateixa edició (Quantum computing: Chemistry from photons), si es poden resoldre els grans reptes que suposa la construcció experimental d’ordinadors quàntics amb molts de qubits. Però també els ordinadors clàssics semblaven una cosa d’una altra galàxia quan Alan Turing va desenvolupar els fonaments computacionals, a mitjans del Segle XX, i en canvi avui els ordinadors, la Internet i la Web 2.0 no és pas que siguin una cosa normal, és que no es poden dissociar de la pròpia societat en què vivim.

He tardat una mica en fer aquesta entrada, des que es va publicar l’article a Nature Chemistry, perquè entendre la computació quàntica no és pas senzill, fins i tot per als químics quàntics com nosaltres a l’IQC. Hem tingut la sort que en Javier García, físic que és professor associat a la UdG en sap i ens ha fet un seminari sobre l’article (després d’haver-ne fet un sobre computació quàntica més general).

ImageEl càlcul tarda uns 3 minuts, degut a la no optimització experimental, on cal moure elements materials, ja que l’ordinador està fet amb qubits de tipus fotònic i per tant amb materials per on passa llum. Un mèrit d’aquest article és que s’ha fet un càlcul de l’hidrogen fent servir un ordinador quàntic real, segurament d’una certa mida (cal recordar que els primers ordinadors digitals ocupaven sales senceres d’un edifici). Això facilitarà que les agències finançadors de la recerca, o les organitzacions més innovadores, apostin per continuar la investigació en computació quàntica. La teoria ja estava força desenvolupada, aquí hi ha una aplicació pràctica.

Crec que encara queda molt de camp per recórrer, i que costarà desenvolupar ordinadors quàntics reals amb un número més elevat de qubits i amb moltes portes quàntiques. Però potser el que m’ha sobtat més a partir de la xerrada d’en Javier i de l’article és la complexitat per preparar el propi càlcul quàntic. La preparació de l’algorisme (podríem dir-ne la preparació) no és pas senzilla per a la molècula d’hidrogen. Per a molècules més grosses, sembla que ha de ser molt complexa. Caldrà treballar perquè hi hagi sistemes d’ús general per a qualsevol sistema molecular, sobretot si es vol aplicar a molècules d’interès biològic.

Però ja que estem en l’àmbit de la química, pot haver-hi un catalitzador: Google està interessada en la computació quàntica (vincles amb D-Wave), perquè hi ha un important algorisme que permet fer cerques molt més ràpidament que no pas amb algorismes de computació clàssica. Si Google hi ajuda, segur que de retruc els químics teòrics-computacionals hi guanyarem.

(Fotos: Chemistry World, Nature Chemistry)

Ocells i quàntica: una idea engrescadora

Image

La Laia (Reacciona, Elkidcientific) em va fer notar una entrada de Tendencias21 en què es comenta que els fenòmens quàntics podien estar involucrats en l’orientació dels ocells que fan servir el camp magnètic terrestre.

Abans de res, he de dir que on hi ha matèria hi ha fenòmens quàntics de forma estricta. I aquests es manifesten sobretot en tractar la matèria a nivell molecular o més petit, així que no és cap descobriment el que diu l’article publicat a Arxiv.Org (deu estar pendent d’acceptació a una revista indexada=.

Més enllà de la curiositat del títol (per cert, la publicació original vé a dir que la interacció entre el camp magnètic terrestre i la transició singlet-triplet no és causa de l’orientació dels ocells), ens trobem amb una altra de les qüestions que poden atraure el públic en general. Tothom s’ha preguntat alguna vegada com s’orienten els ocells, com poden migrar distàncies tan llargues. Per tant, es tracta d’un tema que segur que té acceptació i impacte en jornades de divulgació científica. I per a nosaltres, químics teòrics, un exemple d’aplicació de les coses que estudiem.

Aquesta entrada parla també d’entrellaçament quàntic, un fenòmen molt complicat que jo explico amb un joc de cartes. Amb la gent de la C4D haurem de muntar alguna cosa divertida.

Gràcies, Laia!

Nou tipus d’enllaç químic? Molècula de Rydberg o la Química Quàntica és notícia

Image

En química i en espectroscòpia molecular els estats de Rydberg són ben coneguts. Es tracta d’estats electrònics altament excitats. Seguint la tònica d’aquest Segle XXI, qualsevol troballa singular s’amplifica. Ara he vist que la BBC esmenta la formació d’una molècula de Rydberg entre dos àroms de Rubidi, un en estat de Rydberg (amb un electrò en una òrbita molt llunyana) i un altre en estat fonamental. I la BBC hi diu que s’ha format un ou tipus d’enllaç..

El que em sembla interessant és que Slashdot.com (gràcies!) ho recull ràpidament, i que la Wikipedia ja ho ha recollit a l’entrada en anglès, i ho treuen de la BBC! De fet, l’article ha estat publicat a la revista Nature, amb una nota de l’editor, un comentari d’un teòric i l’article experimental.

I el títol del comentari és força atractiu: Quantum Chemistry: The little molecule that could

Molècules inorgàniques autoreplicants: vida sense carboni?

Acabat de tornar de viatge, veig al recull de la UdG (ABC) una referència a molècules inorgàniques autoreplicants. M’he mirat l’article original al New Journal of Physics, i es tracta d’una simulació computacional.

En tot cas, una idea interessant i que lliga una mica amb l’article de la nostra companya de la UAB Mariona Sodupe al Teraflop 93 (revista del CESCA) sobre els orígens de la vida a l’espai interestel.lar.

Molècules Borromees

borromeu.jpgÉs ben conegut el logotip i la marca de cotxes Toyota. Es tracta dels anells de Borromeu, que apareixen a l’escut d’aquesta família renaixentista del Segle XV.

Al Journal of Chemical Education de maig hi ha un article (i també la portada) sobre un experiment sintétic de química orgànica (que de fet és una pràctica docent) que crea tres anells entrellaçats en forma d’anells de Borromeu.

Em sembla que inventar-se pràctiques de laboratori com aquesta permet a la vegada estimular l’interés dels estudiants i a la vegada introduir una mica conceptes de topologia i de ciència recreativa.